WormBase Tree Display for RNAi: WBRNAi00087520
expand all nodes | collapse all nodes | view schema
WBRNAi00087520 | Homol | Homol_homol | T03F1:RNAi | ||
---|---|---|---|---|---|
W09C3:RNAi | |||||
Sequence_info | DNA_text | gtgtctgctctccttacctggaagattgaccagagacgagtcgacttgtaacgacggttgcactcctcgtagaacccataaacacggttgatggctgggcactcgtggtttccacgaagcatgaagaagttctctggatacttgatcttgaaacataacatcaaacagatcgtctcgatattctgtcttccacgatccacatagtctccaaggaacaggaaattgacatcaggcgggaatccgttcttgtcaaagatgcgcaagagatccgagtactgtccgtggatatctccgcacacgatgatcggcggctcaacctccaggagtgatgcttgggaggcgaataccgatttggccacagcacagcaagtctggagttcctgctcgttgacagaagttgtcagtcttccaccggacatgccgacattgagcaaacggctcatcaagttatcgacatccattggcgctgtcattattgttcttctttactgaaaaattattgatttattggttgtcaacaagaatgatgcatcggagggcttccacataggtaacaaaacgcctgccgcggcggccgtgcggcgacggcaggttttgaaac | |||
Experiment | Date | 01 Mar 2003 00:00:00 | |||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | T03F1.5 | Inferred_automatically | RNAi_primary | |
W09C3.6 | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00021113 | Inferred_automatically | RNAi_primary | ||
WBGene00020187 | Inferred_automatically | RNAi_primary | |||
Transcript | T03F1.5.3 | Inferred_automatically | RNAi_primary | ||
T03F1.5.2 | Inferred_automatically | RNAi_primary | |||
W09C3.6.1 | Inferred_automatically | RNAi_primary | |||
W09C3.6.2 | Inferred_automatically | RNAi_primary | |||
T03F1.5.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00005831 | ||||
Phenotype | WBPhenotype:0000154 | Remark | 30 ~ 40% reduction in the number of C. elegans progeny produced by treated hermaphrodites compared with negative controls. Also, no visible morphological or behavioural defects were observed in worms subjected to the RNAi treatments. | ||
Method | RNAi |