WormBase Tree Display for RNAi: WBRNAi00087277
expand all nodes | collapse all nodes | view schema
| WBRNAi00087277 | Homol | Homol_homol | W02A2:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | agcaatccctgagcactgctttgtcaaggatccattgacttcaatttcatatcttatcaaggattacgtacttctcgctggtctctattttgcagttccatacattgagcattatctcggatggatcgggcttcttggatggtattgggcaatgggaattgttggatccgcattgttctgtgtgggtcatgactgtggacatggatcattctccgattatgaatggctcaatgatctttgtggacatttggctcatgctccaattcttgctccattctggccatggcaaaagtctcatagacaacatcatcaatacacatcccacgtggaaaaggataagggacatccatgggttactgaggaagact | |||
| Experiment | Date | 02 Apr 2008 00:00:00 | |||
| Temperature | 20 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | W02A2.1a | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001394 | Inferred_automatically | RNAi_primary | ||
| Transcript | W02A2.1a.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000517795 | ||||
| WBInteraction000517796 | |||||
| Reference | WBPaper00031804 | ||||
| Phenotype | WBPhenotype:0000050 | ||||
| WBPhenotype:0000054 | |||||
| WBPhenotype:0000136 | Remark | mRNA levels of sod-3, ech-1 (substantially), daf-16 and fasn-1 (modestly) increased upon fat-2(RNAi), as determined by RT-PCR | |||
| WBPhenotype:0000137 | Remark | mRNA levels of acs-2 decreased upon fat-2(RNAi), as determined by RT-PCR | |||
| WBPhenotype:0000351 | Remark | Most fat-2(RNAi) eggs failed to hatch after 2 days | |||
| Penetrance | Range | 80 | |||
| WBPhenotype:0000373 | Remark | Many FAT-2 RNAi eggs exhibited heterogeneous forms and indistinct outlines | |||
| WBPhenotype:0000640 | Remark | Authors recorded an average ovipositional delay of several hours | |||
| WBPhenotype:0001213 | |||||
| WBPhenotype:0001905 | |||||
| Method | RNAi |
