WormBase Tree Display for RNAi: WBRNAi00086891
expand all nodes | collapse all nodes | view schema
| WBRNAi00086891 | Homol | Homol_homol | C29E4:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | agaaagtcaattgctgtgggaggcgagaatcgattgagattgaaaacatttattgctggaagaaatcgtttggaaaatccaggagcacatgcactggcggctacttttaaggctcttgaaacggttgaatggtttgatgttcgtcaaaatggaattcatgaagaaggaattcgtgctctggtggctgcattgaaacacaacagaaatcttcgatatctctggcttgaagacaatacagtactccccaagggtgcaaaggctcttgcaaaaactctggaatcttggccgaagttagaagttttgaatttgtcagactgtttgattcgtgacgctggatgcaattacattattgatcacttgaatcctcaacatcatcgccatcttaaaaatgtttacctttgcggaaacgagctcacaccacccgtcgctaagctcctgattcaaaaatggtcaaagtttgatggtcttacaccgaaaccagtgcttcatattcataccaattcgtttggtgatgaattctctgatgttgctggaatggcaccggaaaatgtgaatgttggagatgaagatgatgatttgggaagtttggatggagatcaagaggagtacaatagtaaatcgtcagattcggaagatgcagatttggatgatgacgatgaagatgatgatgaggaagcggagattcagattatcgacaatggagaatcacagttaaaacttgcaatggatcgaattgatcgtctgg | |||
| Experiment | Date | 01 Dec 2002 00:00:00 | |||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C29E4.3b | Inferred_automatically | RNAi_primary | |
| C29E4.3a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004303 | Inferred_automatically | RNAi_primary | ||
| Transcript | C29E4.3a.1 | Inferred_automatically | RNAi_primary | ||
| C29E4.3b.1 | Inferred_automatically | RNAi_primary | |||
| C29E4.3b.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005637 | ||||
| Phenotype | WBPhenotype:0000062 | ||||
| Phenotype_not_observed | WBPhenotype:0000154 | Remark | 91 to 100% of the embryos failed to hatch. | ||
| Remark | C. elegans RanGAP (ran-2, nt 1789 to 2533 of predicted ORF) was used for RNAi. Only intron-less sequences were amplified. | ||||
| Method | RNAi |
