WormBase Tree Display for RNAi: WBRNAi00086623
expand all nodes | collapse all nodes | view schema
| WBRNAi00086623 | Homol | Homol_homol | K04A8:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | ggcacaaacctggaagccaaaatggagacaacggaatgtgaaccagaagaagaggaggcggtggaagaagaagatcaacaagatcatatcaatagactccccgaagaacttcttctcaaagtgttttcatttcttcctgataaatcgctgcttgcatgtagttcagtctcataccgattcaatcaaatttcgaatagtcatgaagtgtggaaggagctgtattgtaatttatatgactatcgaattccacttttccacccatctcatgcaaaattcgagttccgggaacagagccgttggcgggatggtaatccatggaaagagtcccatcgacagcttcatcatggagttcatgtgatgaaagagccacgggtcaatcttcgatctgtcaactatcgttgtttcgatcaaattgagaaggctcaatcgttcttggaggaggatgagtatagagagaaacttattttcttgcacactggtgttcatgagccaatcgacacaattctcatcaacacagatgtgcagattatcggagcaagtgactcacgagatatcacatcttcggttgttctcgaaggaagtaaaaataccgcattgacattcactgatggaagtgcaaacgcgtatttcggattcatcacagtccggtttcgggctgatccagtgtgcaggcagcagccacagattgctcagcaggctcaacaaatgaatcatttctattcgattttagtgactgataaggatgcaatgccatatattgaaagatgtgatatcacttcgaaagttggaaatggtgcagc | ||||
| Experiment | Laboratory | AA | ||||
| Date | 26 Jan 2007 00:00:00 | |||||
| Genotype | dre-1(dh99) | |||||
| Temperature | 20 | |||||
| Delivered_by | Bacterial_feeding | |||||
| Inhibits | Predicted_gene | K04A8.6b | Inferred_automatically | RNAi_primary | ||
| K04A8.6a | Inferred_automatically | RNAi_primary | ||||
| Gene | WBGene00001089 | Inferred_automatically | RNAi_primary | |||
| Transcript | K04A8.6b.1 | Inferred_automatically | RNAi_primary | |||
| K04A8.6a.2 | Inferred_automatically | RNAi_primary | ||||
| K04A8.6a.1 | Inferred_automatically | RNAi_primary | ||||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00029151 | |||||
| Phenotype | WBPhenotype:0000038 | Remark | Animals often displayed ruptures at the vulva and rectum, and were dumpy. | |||
| EQ_annotations | Life_stage | WBls:0000002 | PATO:0000460 | |||
| WBPhenotype:0000583 | EQ_annotations | Life_stage | WBls:0000002 | PATO:0000460 | ||
| WBPhenotype:0000638 | Remark | Animals exhibited molting defects at L1mL4m, with greatest penetrance at the L3 molt and L4 molt (18% and 16%, n > 23, respectively) | ||||
| EQ_annotations | Life_stage | WBls:0000002 | PATO:0000460 | |||
| WBPhenotype:0000910 | EQ_annotations | Life_stage | WBls:0000002 | PATO:0000460 | ||
| Method | RNAi |
