WormBase Tree Display for RNAi: WBRNAi00085212
expand all nodes | collapse all nodes | view schema
| WBRNAi00085212 | Homol | Homol_homol | K01A2:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgttctatttcctattggtccaatggagtaaagccgataatccagttctcacacattttcagattttctgcctggtgattattggaatcggatttttgattatcttgatcttaatattcagtatttttaaatccgaaatgaaaagtgactcacatgcaagacgattctttcatatttggccactggtacatatcgccttatccaccgcctatcagctcttcacgcaaattgtgatatctcattggaaaacttaccagatcccaatcctctactcatcctatgcaactaccgtctctgtttgcattcatttagttctgcactccatggcggttttttggaaagtataa | |||
| Experiment | Laboratory | FDX | |||
| Date | 30 Mar 2005 00:00:00 | ||||
| Genotype | mps-3::gfp | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | K01A2.8a | Inferred_automatically | RNAi_primary | |
| K01A2.12 | Inferred_automatically | RNAi_primary | |||
| K01A2.8d | Inferred_automatically | RNAi_primary | |||
| K01A2.8c | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00086561 | Inferred_automatically | RNAi_primary | ||
| WBGene00019282 | Inferred_automatically | RNAi_primary | |||
| Transcript | K01A2.12.1 | Inferred_automatically | RNAi_primary | ||
| K01A2.8d.1 | Inferred_automatically | RNAi_primary | |||
| K01A2.8c.1 | Inferred_automatically | RNAi_primary | |||
| K01A2.8a.1 | Inferred_automatically | RNAi_primary | |||
| K01A2.8c.2 | Inferred_automatically | RNAi_primary | |||
| K01A2.8c.3 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00025063 | ||||
| Phenotype | WBPhenotype:0001278 | Remark | GFP fluorescence of the transgene in ADF neurons is reduced with this RNAi. | ||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation (K01A2.8c.1). | ||||
| Method | RNAi |
