WormBase Tree Display for RNAi: WBRNAi00083942
expand all nodes | collapse all nodes | view schema
| WBRNAi00083942 | Homol | Homol_homol | ZK1127:RNAi | ||
|---|---|---|---|---|---|
| T02G5:RNAi | |||||
| Sequence_info | DNA_text | atgtctctgggtactccaagtgaaccgacttcgactctcgaatcagacatttttgacgatctttcgttgtattatctagaggatgtattcctttccgccacaacgccgtcgccaacatttgatttgagtgatccatcggatccatcactttcggattcgtttgacagtgaatggtcaccaatgactccatgctcaatagaaagaccggagacctcaacatcatcaatcttctcgtttgaagctagacccatcaaaacgccgccacctgccgaatatcttcgacttccgacattcctgtcaacgaataattccggatttttcgattcagttgtcgcttcggatttcaatttgtacgggaagttcaatgattggttgaatgacagcaagcctcgcagtggatcgtttgcgattgaatctgctgaagagctcgcgaggaatccaagagaaactcgctccgagcccgaagtgccatcattgttcaaaaggcgtgaatatggatgtggatactgtcgttccgttggatatatgcgatgggaaacgcatacacgtaagaaatgcgacaagctcagctcattggctccatgtaaaatttgtggagctcgcggtgaaatgaatcacaccgagacgtactgcccaatgaagccgtcgagccagttgttcttcaatgaggatttcagccgagacttcgaaaaccgacgattccagcgcagtcgttatcaattttacaagcattcctcattaattcagaagatctacgcatcatccgaagattctttctag | |||
| Experiment | Laboratory | KW | |||
| Date | 10 Oct 2003 00:00:00 | ||||
| Genotype | nos-1(gv5) | ||||
| Treatment | Authors observed Z2/Z3 cells (germline precursors) that were stained w/ H3meK4 antibodies. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | ZK1127.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00003784 | Inferred_automatically | RNAi_primary | ||
| Transcript | ZK1127.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000051960 | ||||
| Reference | WBPaper00006223 | ||||
| Phenotype | WBPhenotype:0000688 | Remark | Sterility as adults. | ||
| Penetrance | Range | 59 | |||
| WBPhenotype:0001383 | Remark | Some embryos exhibited inappropriate staining for H3meK4 in one or both of the primordial germ cells (Z2/Z3). | |||
| Method | RNAi |
