WormBase Tree Display for RNAi: WBRNAi00083933
expand all nodes | collapse all nodes | view schema
| WBRNAi00083933 | Homol | Homol_homol | F52B10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gatggctgctcttgaggccaaggttcaatatcttgaggatcaattgaatgttgagggacaagagaagactgctgccaacagagctgctagacgactcgagaagagattgaacgacacgacacaacaatttgaagatgagaagagggctaacgagcaagctaaagaattgctggagaaatcgaacctcaaaaacagaaatctccgtcgccaattggatgaagctgaagacgagatgtcacgagaacgcacaaagcatcgtaatgtgcagcgtgaagccgacgatcttctcgatgctaacgagcaactgactcgagaacttatgaatcttcgaggaaacaatagacggcgcgctgatatgcgtcttcgtagaggcttcgatgttcccggatcaagtgataatcttgctcgtgaagaggaaaacgaatctaatgtgtccggatctgaacacggaatgtcggtgaac | |||
| Experiment | Laboratory | JJ | |||
| Date | 23 Jul 2003 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F52B10.1a | Inferred_automatically | RNAi_primary | |
| F52B10.1b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00003776 | Inferred_automatically | RNAi_primary | ||
| Transcript | F52B10.1a.1 | Inferred_automatically | RNAi_primary | ||
| F52B10.1b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00006199 | ||||
| Phenotype_not_observed | WBPhenotype:0000708 | Remark | The pattern of endodermal cell ingression was not altered by depleting NMY-1 | ||
| Method | RNAi |
