WormBase Tree Display for RNAi: WBRNAi00083308
expand all nodes | collapse all nodes | view schema
| WBRNAi00083308 | Homol | Homol_homol | C07G1:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | gatccactccaacacgacaattcgaaatcacacaggcttatggaggaacaattcgaggacctccaatggcaattggcggaggtcaagggataacacaaatgggaactatggctgctgcaccacaatcacatacacatacagatggaaatgctagcagtagtggatcatggttccggaaagataaaaacaaaaagaaggataaaaaatcgaaaattaagaaagaggatatttctaatccaacaaactttcaacataaagctcatgttggatggaatcaggatagtggattctcgaatacagtttacgacgatgatatggatgaagctactaaaaatattctaaaggctgctggattggaaagcaataatctgaatgaggatgataagaaattcgtgaaaaaattcattgccaagaactatgataaatatgtatctgttggaagtttggatccatcacaaatctcatcacctcttccaccaccaattcagcaacatccacagatgaatcagtcatggaatcaaacaccagtgcgtcaatacaaaccatcattcccatcatctgctccgattggaagcggtgc | ||||
| Experiment | Laboratory | YM | ||||
| Date | 08 Jan 2003 00:00:00 | |||||
| Genotype | lin-26::wsp-1 | |||||
| Delivered_by | Transgene_expression | |||||
| Inhibits | Predicted_gene | C07G1.4a | Inferred_automatically | RNAi_primary | ||
| C07G1.4b | Inferred_automatically | RNAi_primary | ||||
| Gene | WBGene00006957 | Inferred_automatically | RNAi_primary | |||
| Transcript | C07G1.4b.1 | Inferred_automatically | RNAi_primary | |||
| C07G1.4a.1 | Inferred_automatically | RNAi_primary | ||||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00005843 | |||||
| Phenotype | WBPhenotype:0000050 | Remark | Animals die as embryos and do not form a normal worm shape; expression of WSP-1 is reduced specifically in hypodermis, as indicated by antibody staining | |||
| Penetrance | Range | 63 | ||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
| WBPhenotype:0000425 | EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | ||
| WBPhenotype:0001136 | EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | ||
| Remark | Hypodermal cell-specific RNAi was achieved by expressing sense and anti-sense RNA under the control of the lin-26 promoter | |||||
| Method | RNAi |
