WormBase Tree Display for RNAi: WBRNAi00083293
expand all nodes | collapse all nodes | view schema
| WBRNAi00083293 | Homol | Homol_homol | C35D10:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | catatctggaggccgtgcgtcacacgctccaggcagctctctgtcttgagcaattcagttcgcaggtggtcgagagacacaacaaaccagaagtggaagttcaaacatcgaaagaactgctcatgacgccagttgttgttgctcgaaacaaacaggaacgagtactcatcgaaccctccgtcaattctgtcagaatatcaatcgccatcaaacaatccgacgaaatcgagaagattctgtgccacaagttcactcgattcatgtgccaaagagccgataacttctttgtgctccgtcgcaagccactgccaggttatgacatctcgttcctcatcacagcatctcacacagaagcaatgt | ||||
| Experiment | Laboratory | YM | ||||
| Date | 08 Jan 2003 00:00:00 | |||||
| Treatment | L4 larvae were washed with M9 several times and placed on an NGM plate without OP50 for 1 hour. Five worms were selected and immersed in RNA solution for 24 hours and then allowed to recover by incubation at 20C on NGM plates for 36 hours before observation. | |||||
| Delivered_by | Soaking | |||||
| Inhibits | Predicted_gene | C35D10.16 | Inferred_automatically | RNAi_primary | ||
| Gene | WBGene00000204 | Inferred_automatically | RNAi_primary | |||
| Transcript | C35D10.16.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00005843 | |||||
| Phenotype | WBPhenotype:0000050 | Penetrance | Range | 88 | ||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
| Method | RNAi |
