WormBase Tree Display for RNAi: WBRNAi00082850
expand all nodes | collapse all nodes | view schema
WBRNAi00082850 | Homol | Homol_homol | F48C11:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | catcatcgccaactgctctagcacaacaactttcctatccaccaccactccagtctcttcaacaacttctaacatttcattaacgtcatcatcaacgcaatcctattcgtcatcaactgcaggtgcaacttcttcacttttcaccataaaagttactcaatcaaccac | |||
Experiment | Laboratory | UR | |||
Date | 29 Oct 2009 00:00:00 | ||||
Genotype | pkd-2::cwp-5(hairpin RNAi) | ||||
Treatment | pkd-2::cwp-5(hairpin RNAi) is the cwp-5 stem-loop transcript under the control of the pkd-2 promoter. Authors used several independent lines. | ||||
Delivered_by | Transgene_expression | ||||
Inhibits | Predicted_gene | F48C11.2a | Inferred_automatically | RNAi_primary | |
F48C11.2b | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00009844 | Inferred_automatically | RNAi_primary | ||
Transcript | F48C11.2a.1 | Inferred_automatically | RNAi_primary | ||
F48C11.2b.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00036024 | ||||
Phenotype | WBPhenotype:0004004 | Remark | cwp-5(RNAi), mediated by a RNA hairpin expressed in the polycystin neurons, reduced male mating response behavior. | ||
Method | RNAi |