WormBase Tree Display for RNAi: WBRNAi00082052
expand all nodes | collapse all nodes | view schema
| WBRNAi00082052 | Homol | Homol_homol | F17E9:RNAi | ||
|---|---|---|---|---|---|
| ZK131:RNAi | |||||
| K03A1:RNAi | |||||
| B0035:RNAi | |||||
| F08G2:RNAi | |||||
| F55G1:RNAi | |||||
| F07B7:RNAi | |||||
| K06C4:RNAi | |||||
| Sequence_info | DNA_text | atggctcgtactaagcaaaccgcccgtaaatcgaccggaggaaaggctccaagaaagcaattggccaccaaggctgcccgtaaatcggctccagcttccggaggtgtcaagaagccacatcgttatcgtccaggaaccgtcgctctacgtgagatcagacgttaccagaaatccaccgagcttctcattcgtagagcgccattccagcgtcttgtccgtgagattgctcaggatttcaagaccgatctccgattccagtcttcagctgttatggctcttcaagaggccgccgaggcttacctcgtcggacttttcgaggataccaacttgtgtgccatccatgctaagcgagttaccattatgccaaaggacatccaattggcaagacgtatccgaggagagcgtgcttaa | |||
| Experiment | Laboratory | YM | |||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F08G2.3 | Inferred_automatically | RNAi_primary | |
| ZK131.2 | Inferred_automatically | RNAi_primary | |||
| ZK131.7 | Inferred_automatically | RNAi_primary | |||
| ZK131.3 | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00001899 | Inferred_automatically | RNAi_primary | ||
| WBGene00001883 | Inferred_automatically | RNAi_primary | |||
| WBGene00001916 | Inferred_automatically | RNAi_primary | |||
| WBGene00001887 | Inferred_automatically | RNAi_primary | |||
| Transcript | ZK131.7.1 | Inferred_automatically | RNAi_primary | ||
| F08G2.3.1 | Inferred_automatically | RNAi_primary | |||
| ZK131.3.1 | Inferred_automatically | RNAi_primary | |||
| ZK131.2.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005085 | ||||
| Phenotype | WBPhenotype:0000241 | ||||
| WBPhenotype:0000242 | |||||
| WBPhenotype:0000707 | Remark | Detached pharynxes at the terminal stage. | |||
| WBPhenotype:0000867 | Remark | Embryos arrest with around 50 cells in both cases. | |||
| WBPhenotype:0010004 | Remark | Appearance and elimination of cell corpses is delayed. | |||
| Method | RNAi |
