WormBase Tree Display for RNAi: WBRNAi00082052
expand all nodes | collapse all nodes | view schema
WBRNAi00082052 | Homol | Homol_homol | F17E9:RNAi | ||
---|---|---|---|---|---|
ZK131:RNAi | |||||
K03A1:RNAi | |||||
B0035:RNAi | |||||
F08G2:RNAi | |||||
F55G1:RNAi | |||||
F07B7:RNAi | |||||
K06C4:RNAi | |||||
Sequence_info | DNA_text | atggctcgtactaagcaaaccgcccgtaaatcgaccggaggaaaggctccaagaaagcaattggccaccaaggctgcccgtaaatcggctccagcttccggaggtgtcaagaagccacatcgttatcgtccaggaaccgtcgctctacgtgagatcagacgttaccagaaatccaccgagcttctcattcgtagagcgccattccagcgtcttgtccgtgagattgctcaggatttcaagaccgatctccgattccagtcttcagctgttatggctcttcaagaggccgccgaggcttacctcgtcggacttttcgaggataccaacttgtgtgccatccatgctaagcgagttaccattatgccaaaggacatccaattggcaagacgtatccgaggagagcgtgcttaa | |||
Experiment | Laboratory | YM | |||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | F08G2.3 | Inferred_automatically | RNAi_primary | |
ZK131.2 | Inferred_automatically | RNAi_primary | |||
ZK131.7 | Inferred_automatically | RNAi_primary | |||
ZK131.3 | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00001899 | Inferred_automatically | RNAi_primary | ||
WBGene00001883 | Inferred_automatically | RNAi_primary | |||
WBGene00001916 | Inferred_automatically | RNAi_primary | |||
WBGene00001887 | Inferred_automatically | RNAi_primary | |||
Transcript | ZK131.7.1 | Inferred_automatically | RNAi_primary | ||
F08G2.3.1 | Inferred_automatically | RNAi_primary | |||
ZK131.3.1 | Inferred_automatically | RNAi_primary | |||
ZK131.2.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00005085 | ||||
Phenotype | WBPhenotype:0000241 | ||||
WBPhenotype:0000242 | |||||
WBPhenotype:0000707 | Remark | Detached pharynxes at the terminal stage. | |||
WBPhenotype:0000867 | Remark | Embryos arrest with around 50 cells in both cases. | |||
WBPhenotype:0010004 | Remark | Appearance and elimination of cell corpses is delayed. | |||
Method | RNAi |