WormBase Tree Display for RNAi: WBRNAi00081760
expand all nodes | collapse all nodes | view schema
WBRNAi00081760 | Homol | Homol_homol | M117:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | tggacatctgacgttggagctgaagatcaagagcaggagggaaaccaggaagctggaaactaagtacgatttcaaaatgttttatgccattatataaagctgacctttttcctcttttcc | |||
Experiment | Laboratory | KK | |||
Date | 04 Oct 2001 00:00:00 | ||||
Treatment | Examined the distributions of PAR-1, PAR-2, PAR-3, PAR-6, and PKC-3 in par-5 RNAi embryos using antibodies for specific proteins. | ||||
Inhibits | Predicted_gene | M117.2b | Inferred_automatically | RNAi_primary | |
M117.2a | Inferred_automatically | RNAi_primary | |||
Gene | WBGene00003920 | Inferred_automatically | RNAi_primary | ||
Transcript | M117.2a.1 | Inferred_automatically | RNAi_primary | ||
M117.2a.2 | Inferred_automatically | RNAi_primary | |||
M117.2a.3 | Inferred_automatically | RNAi_primary | |||
M117.2b.1 | Inferred_automatically | RNAi_primary | |||
M117.2a.4 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Interaction (11) | |||||
Reference | WBPaper00005079 | ||||
Phenotype | WBPhenotype:0000436 | Remark | par-5 activity is required in the first cell cycle for the asymmetric cortical localization of PAR-1 and PAR-2 to the posterior, and PAR-3, PAR-6, and PKC-3 to the anterior. | ||
Method | RNAi |