WormBase Tree Display for RNAi: WBRNAi00078915
expand all nodes | collapse all nodes | view schema
| WBRNAi00078915 | Homol | Homol_homol | Y37A1B:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggctcaggtgaaagccgagtatgattttcaaagtcaaccaaacacaggcgaactgtcaatctcggctggcgaagttttgacggttattcgagagaacatcgacggaggatggatagaaggtcgaaacgtgcgtggatccgtcggactctttcccgaatcctacgtaactccctatcaagcttctcgtccgccaccggtcctaccaccaccactcccaccaacttcaagcggtccaccagctgcctcatcgcgtccttttgatgattggggaggcgcttcagaagttgctgctccaccatcctacggagcccaacatcatcatcagccaacgccatctgtaccggaagtcactagatcttcatatccatcacagaatgatgattttgacgatgaatggacggatgaggatgatgagcaggtatttttaaaattttattttaattttttgattgtccagtttctgtccgtcctatttataccctctaactcctaa | |||
| Experiment | Laboratory | GS | |||
| Date | 07 Nov 2003 00:00:00 | ||||
| Genotype | gap-1(0) | ||||
| Inhibits | Predicted_gene | Y37A1B.2b | Inferred_automatically | RNAi_primary | |
| Y37A1B.2c | Inferred_automatically | RNAi_primary | |||
| Y37A1B.2a | Inferred_automatically | RNAi_primary | |||
| Y37A1B.2d | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00003086 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y37A1B.2c.1 | Inferred_automatically | RNAi_primary | ||
| Y37A1B.2a.1 | Inferred_automatically | RNAi_primary | |||
| Y37A1B.2b.1 | Inferred_automatically | RNAi_primary | |||
| Y37A1B.2d.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000050850 | ||||
| Reference | WBPaper00006348 | ||||
| Phenotype | WBPhenotype:0000700 | Remark | gap-1(0) animals alone do not perturb vulval induction but in combination with this RNAi cause ectopic induction of P3.p, P4.p, and P8.p. | ||
| Remark | Exact sequence used for RNAi not stated by authors, spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
