WormBase Tree Display for RNAi: WBRNAi00078678
expand all nodes | collapse all nodes | view schema
| WBRNAi00078678 | Homol | Homol_homol | C41C4:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | tatagtcatacttttcaatttccggttttcagcttcagctcccctcccccaaaaacttgtgaaaacgaaaaaattcaatttcctgtatttaatctacaattttattgtcgagaattacacaaaaaaatgacgaccagtatcgaaaaatcgagttatcacaagttaccgtacgatatatgaagggagtgcattcataggaaatgcagaaaaagaaacgggatcataattcgacaaaaatgggtaggtaggcgaggagagatccgaaaaaacattaaaggataaacacagaggaaacatgaggacaagaccattggacagaaatcccagaataatgataataaatttacacacgcaaacacatcgtcgatgttcttcaaacggcaaaaacggcacttcgaaaagctttgttaaatgattgataactgattctaaaacccagaaacttggtatataataattattggttaaatccaactattctcactacttgcagagtgattaatcggtgttcggatttgatttctttttgatattcctcttatccaattttagaggagttcgttgctcgacaggttttggtgctcgtgcccacacctcatttgccatttcttctttaatcttctttcttactctctcttcttcttcca | |||
| Experiment | Laboratory | SJ | |||
| Date | 23 Nov 2001 00:00:00 | ||||
| Genotype | hsp-4::gfp | ||||
| Treatment | Worms treated with tunicamycin to induce the unfolded protein response (UPR). hsp-4::gfp is a reporter for the UPR. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | C41C4.4b | Inferred_automatically | RNAi_primary | |
| C41C4.4a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002147 | Inferred_automatically | RNAi_primary | ||
| Transcript | C41C4.4b.1 | Inferred_automatically | RNAi_primary | ||
| C41C4.4a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000003486 | ||||
| Reference | WBPaper00005036 | ||||
| Phenotype | WBPhenotype:0000359 | Remark | Inactivation of ire-1 function by RNAi blocked both basal and inducible hsp-4::gfp expression in response to tunicamycin. Tunicamycin, in control animals, induces ER stress. | ||
| WBPhenotype:0001719 | Remark | RNAi of this gene abolished the unfolded protein response to tunicamycin stress. | |||
| Method | RNAi |
