WormBase Tree Display for RNAi: WBRNAi00078672
expand all nodes | collapse all nodes | view schema
| WBRNAi00078672 | Homol | Homol_homol | ZK39:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgagttggaacattttattaatattactcatttcgaatttggacgaagttttggcaaaaaccctgctgaaactgccgtcaaatgcgccgcccggatggctaatcagtgatcttcaatttcaaaatctcatcggcgactcggaaatcgccacgttgcagccatcgatttttagcacaaattttgaagtggaggatgggtacaggataatcaccaacactaccgtaacccaattccacggagagctcttcgaactatttttgaacgtaaaagagcaaaatttccaacgcctggtaactctccacgtctatgtagatccacgtggtacatcccagcagccggcaacttttctatctaccgtataccatgctaccgtatacacgtcacagcagcccgggagtactgtagttttctcgaagccgattacagttaggaatcggaaaaatttcgtgatttctccaatttcgaaaatcgataaaatcagtaaatacagcagtccgttttccgtgatgacacgtggaaaatcagtcgatattgtgatgatgaagcagaagcttgaggaggatgacatcacgcgccacgttatttttctcggagcatttacagagaagacaggggaaatgattgcccaaaccaaagtgatcattgacgttatcgactctggagatgtgcattttctgctgaaatccaaaaaatcgatcgcaaagttcgcatctgcaattccggccaattcaacggtgtttgacgtggaaaaaagaaacctctcggagcccctcctctttcaccttgaagagccatcccgatttttcaaaattgatcaattctctggccgagtttctaccgtactcccagtaggttacggtacctaccatatccacgtggtcgcccgaaaccagaaaaaacaaagatccgatgcttggctcgagatttcggtgaaaaaagagcagaagctggagccgatgacatcatcacgttcgcggcggcatctggatgatattgtat | |||
| Experiment | Laboratory | PE | |||
| Date | 30 Oct 2001 00:00:00 | ||||
| Treatment | For RNAi the authors used a transgenic strain designed to express a snapback double-stranded RNA derived from HMR-1B-specific coding sequences, under the control of the HMR-1B promoter. | ||||
| Delivered_by | Transgene_expression | ||||
| Inhibits | Predicted_gene | W02B9.1b | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001980 | Inferred_automatically | RNAi_primary | ||
| Transcript | W02B9.1b.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005031 | ||||
| Phenotype | WBPhenotype:0000180 | ||||
| WBPhenotype:0000632 | Remark | One or more axons crossing into the left-hand tract in the VNC. | |||
| WBPhenotype:0001226 | Remark | One or more commissures follow aberrant trajectories and fail to reach the dorsal cord. | |||
| WBPhenotype:0001767 | Remark | One or more commissures follow aberrant trajectories along the opposite side of the animal to the canonical commissural routes (commissure sidedness). | |||
| Remark | Exact sequence used for RNAi not stated by authors, first 1000 bases of the hmr-1b spliced coding region sequence of gene used for curation. | ||||
| Method | RNAi |
