WormBase Tree Display for RNAi: WBRNAi00078166
expand all nodes | collapse all nodes | view schema
| WBRNAi00078166 | Homol | Homol_homol | C15H9:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gtccgaccacctacggaaaatgaagtctctaaacttaaaagcgggtgcacattgatttctttcatacatccaggacaaaatcaagctctacttgattcactgactaaaaccgacaagaccgtttttgcaatggattgtgtgcccagaattagccgagcacaagtatttgatgcgttatcctcaatggcaaatatcgctggataccgtgcagttattgaggctgccaaccattttggaagattctttactgggcagattactgctgctggtaaagttccacctgcaaaagtacttgtaattggtgggggagtagccggattaagcgcaattggaacatcacgaggaatg | |||
| Experiment | Date | 05 Feb 2005 00:00:00 | |||
| Treatment | Worms treated with methyl viologen to cause oxidative stress. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | C15H9.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00003778 | Inferred_automatically | RNAi_primary | ||
| Transcript | C15H9.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00025185 | ||||
| Phenotype | WBPhenotype:0001621 | Remark | Animals showed reduced resistance to oxidative stress induced by methyl viologen as observed by growth rate and survival. | ||
| Method | RNAi |
