WormBase Tree Display for RNAi: WBRNAi00078125
expand all nodes | collapse all nodes | view schema
| WBRNAi00078125 | Homol | Homol_homol | W03F8:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgagtgacgttgacgctgatgaggcgcgcaaaatggcggagcgcgagcgcaagaaggaagaggtgcgtaagcgtctcgaggaggcctcaagaatgaagaaagccaagaaaggattcttgacacctgagagaaagaagaagcttcgtaagcttttgatgatgaaggccgccgaagatttgaagcaacaacaaatgttgaaagagcaagagagacaacgtattcttcaagaaagaatcattccacttccagatttggataacgaagatgacctcgaggcagtctacgatgaaatccgcgagagactcatcgatcttgagtctgaaaactatgacgtcagctacatcgttcgtcaaaaggatttcgagatcaacgagttgaccattgctgtcaacgatcttcgcggaaaattcgtgaagccaaccctgaagaaggtgtccaagaccgagggaaaattcgacaagcttaagaagaaggaagccaccaaagtcgatttccgtgctcaactcaaggttgtcgacaagaacgaattcgcactcgatgaggaagacactgagaagaaggagaaagccgcgtgggctaagtaa | |||
| Experiment | Laboratory | HK | |||
| Date | 02 Dec 2004 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | W03F8.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00006586 | Inferred_automatically | RNAi_primary | ||
| Transcript | W03F8.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00025009 | ||||
| Phenotype | WBPhenotype:0000019 | Remark | 15 percent of surviving tni-4 (RNAi) animals showed no pharynx pumping but grew normally. | ||
| WBPhenotype:0000050 | Remark | Dead embryos before the comma stage. RNAi caused arrest at gastrulation. | |||
| Penetrance | Range | 70 | |||
| Method | RNAi |
