WormBase Tree Display for RNAi: WBRNAi00077959
expand all nodes | collapse all nodes | view schema
| WBRNAi00077959 | Homol | Homol_homol | F57A10:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gtcggaatgaacccccttgcaatggaagttgatgagaaagcagcgtcgtcgtcaaactttaagaaactagtgaaacgagcgcaggatctagagccggatgatgactgtcaagtgacggctgttgttaataaaatgcaaattgtaaaaccagtcgattctatagaaagcaaaatgcaaaacataaccgacatgctggtttacttggagacaaaagttgaaagatttcgaaaatccgcgtataacccgcattggaatgagttcagcgggctggagtacctgctggagtcggagtgtaggatcggatttggcgatagattcgggcctatgcccggatggcctcttcgaagggatcagctaggtccgccaagactaccgaaaccaccatccccagggaaaccgagagactcacaacacagtcaaaacataaaacaatggttcttctacaatttactgacaactgtcgaatacgccaaaacgttcatgttctttcatcgactcagctctcgagacaagctgattctaactaggcacgtggcattggcttgtacgaaccttcatatctcgtactcatcgattagaaggaatttagaggttatcattgagcctgacggatcggaacccatgactttcaacgatacccattattcggcttctgtgatgtctgttgcaccgttgatcc | |||
| Experiment | Laboratory | KV | |||
| Date | 03 May 2007 00:00:00 | ||||
| Strain | WBStrain00034582 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F57A10.5 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00003650 | Inferred_automatically | RNAi_primary | ||
| Transcript | F57A10.5.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00030774 | ||||
| Phenotype | WBPhenotype:0000035 | ||||
| WBPhenotype:0000701 | Remark | Mis-positioned seam cells in the head and tail regions; arranged as side by side doublets rather than in a single row as in wild-type embryos; in some embryos the seam cells were completely missing or disorganized. | |||
| Method | RNAi |
