WormBase Tree Display for RNAi: WBRNAi00077373
expand all nodes | collapse all nodes | view schema
| WBRNAi00077373 | Homol | Homol_homol | Y105E8B:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | cccctccaatttgaatcgtcgatactccgtgtgttcaacacaacaacaaactaccaaaaatggacgccattaagaagaagatgcaggccatgaagatcgagaaggacaacgctctcgatcgtgccgatgccgctgaagagaaagtccgtcagatcaccgagaagctcgaaagagtcgaggaagagctcagagacacccagaagaagatgactcagaccggagacgatttggacaaggctcaggaggacctctccgccgccacctccaagctcgaggagaaggagaagaccgttcaagaggctgaggctgaggtcgcttctttgaaccgtcgcatgaccctcctcgaggaagagctcgagagagccgaggagcgtctgaagatcgccaccgagaagctcgaagaggctacccacaatgtcgacgagtctgagcgcgtgcgcaaggttatggagaaccgctcccttcaggatgaggagcgcgccaacaccgttgaggcccaacttaaggaggctcaacttctcgccgaggaggctgaccgcaaatacga | |||
| Experiment | Laboratory | ON | |||
| Date | 26 Jun 2007 00:00:00 | ||||
| Genotype | unc-87(e1216) | ||||
| Treatment | L4 larvae were treated with RNAi, and phenotypes were characterized in their F1 generation. | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene (14) | ||||
| Gene | WBGene00002978 | Inferred_automatically | RNAi_primary | ||
| Transcript (14) | |||||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000009172 | ||||
| Reference | WBPaper00030902 | ||||
| Phenotype | WBPhenotype:0001354 | Remark | RNAi suppressed the formation of actin aggregates from 100 percent of unc-87(e1216) animals affected to 34 percent affected. Wavy actin bundles were also diminished. The defined striated pattern of actin filaments was not completely restored in the unc-87 mutant. | ||
| Penetrance | Range | 34 | |||
| Method | RNAi |
