WormBase Tree Display for RNAi: WBRNAi00077318

WBRNAi00077318 Homol: Homol_homol: C09G4:RNAi
  Sequence_info: DNA_text: atgacaactggaaacaatgatttctactattcaaacaaatacgaagatgatgagttcgagtaccgtcacgttcatgtcaccaaggatgtttccaagcttatcccaaaaaatcgattgatgtccgaaacagagtggagaagtcttggaattcaacagtccccaggatggatgcactacatgattcacggacccgagcgtcacgtgcttcttttccgcagaccattggcagctacacaaaaaaccggaggaaatgttcgttctggaaatgctgttggagttcgctaa
  Experiment: Laboratory: SS
    Date: 15 Sep 2000 00:00:00
    Delivered_by: Injection
  Inhibits: Predicted_gene: C09G4.3 Inferred_automatically: RNAi_primary
    Gene: WBGene00001051 Inferred_automatically: RNAi_primary
    Transcript: C09G4.3.1 Inferred_automatically: RNAi_primary
  Species: Caenorhabditis elegans
  Reference: WBPaper00004803
  Phenotype: WBPhenotype:0000773 Remark: Each spindle is associated with multiple pieces of DNA. Later-stage embryo containing many spindle poles. Little DNA is associated with the spindles.
    WBPhenotype:0000775 Remark: defects in completion of maternal meiosis, embryos fail to exit M phase properly
    WBPhenotype:0000867
    WBPhenotype:0001130 Remark: no signs of nuclear envelope reformation
    WBPhenotype:0001147 Remark: he embryo pinches off an anterior body of cytoplasm containing DNA whichis interpreted to be an abnormally large polar body.
    WBPhenotype:0001159 Remark: no maternal pronucleus forms
    WBPhenotype:0001216
    WBPhenotype:0001378 Remark: During the first cell cycle in cks-1(RNAi) embryos the centrally located chromosomes condensed, assumed a metaphase configuration and underwent anaphase separation. The metaphase and anaphase masses of DNA appeared more ragged than in wild type, and the chromosomesstayed condensed and did not return to an interphase morphology.
    WBPhenotype:0001743 Remark: embryos fail to exit M phase properly
  Method: RNAi