Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for RNAi: WBRNAi00077318

expand all nodes | collapse all nodes | view schema

Name Class

WBRNAi00077318HomolHomol_homolC09G4:RNAi
Sequence_infoDNA_textatgacaactggaaacaatgatttctactattcaaacaaatacgaagatgatgagttcgagtaccgtcacgttcatgtcaccaaggatgtttccaagcttatcccaaaaaatcgattgatgtccgaaacagagtggagaagtcttggaattcaacagtccccaggatggatgcactacatgattcacggacccgagcgtcacgtgcttcttttccgcagaccattggcagctacacaaaaaaccggaggaaatgttcgttctggaaatgctgttggagttcgctaa
ExperimentLaboratorySS
Date15 Sep 2000 00:00:00
Delivered_byInjection
Inhibits (3)
SpeciesCaenorhabditis elegans
ReferenceWBPaper00004803
PhenotypeWBPhenotype:0000773RemarkEach spindle is associated with multiple pieces of DNA. Later-stage embryo containing many spindle poles. Little DNA is associated with the spindles.
WBPhenotype:0000775Remarkdefects in completion of maternal meiosis, embryos fail to exit M phase properly
WBPhenotype:0000867
WBPhenotype:0001130Remarkno signs of nuclear envelope reformation
WBPhenotype:0001147Remarkhe embryo pinches off an anterior body of cytoplasm containing DNA whichis interpreted to be an abnormally large polar body.
WBPhenotype:0001159Remarkno maternal pronucleus forms
WBPhenotype:0001216
WBPhenotype:0001378RemarkDuring the first cell cycle in cks-1(RNAi) embryos the centrally located chromosomes condensed, assumed a metaphase configuration and underwent anaphase separation. The metaphase and anaphase masses of DNA appeared more ragged than in wild type, and the chromosomesstayed condensed and did not return to an interphase morphology.
WBPhenotype:0001743Remarkembryos fail to exit M phase properly
MethodRNAi