WormBase Tree Display for RNAi: WBRNAi00070600
expand all nodes | collapse all nodes | view schema
| WBRNAi00070600 | Homol | Homol_homol | F53G12:RNAi | ||
|---|---|---|---|---|---|
| F56C11:RNAi | |||||
| Sequence_info | DNA_text | agcgatgtgcaaatgaaggagcatctcgttgtcggttggcatctgcacatccttcagctatactttcattcaagtttacaggtccacaactgaacactccgattttggattgctgcaaatttgctttatttagaggttaaaaagcatttaactaacctccttatgttcactctgaataaattggaagaaagctttgaagttgggccgtccgaaatggttcttagcgtggagaccagtaaacattgaaattcctgagttggtggcacggaagtgcttctcgcaaatgt | |||
| Experiment | Date | 03 Jul 2001 00:00:00 | |||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F53G12.3 | Inferred_automatically | RNAi_primary | |
| F56C11.1 | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00018771 | Inferred_automatically | RNAi_primary | ||
| WBGene00000253 | Inferred_automatically | RNAi_primary | |||
| Transcript | F56C11.1.1 | Inferred_automatically | RNAi_primary | ||
| F53G12.3.1 | Inferred_automatically | RNAi_primary | |||
| F56C11.1.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004841 | ||||
| Phenotype | WBPhenotype:0000025 | ||||
| WBPhenotype:0000545 | |||||
| WBPhenotype:0000583 | |||||
| WBPhenotype:0000643 | Remark | Inability to move on plates in a normal serpentine manner. Affected animals were either completely paralyzed or moved only the anterior region. | |||
| WBPhenotype:0000644 | Remark | animals were either completely paralyzed or moved only the anterior region | |||
| WBPhenotype:0000948 | Remark | grossly abnormal with frequent separation between the cortical and the basal layers | |||
| WBPhenotype:0001010 | |||||
| WBPhenotype:0001515 | Remark | broken and distended struts | |||
| WBPhenotype:0001523 | Remark | Absence of tyrosine cross-linking in the ECM. Cross-linking of collagen and other cuticle proteins in nematodes occurs through di- and trityrosine linkages. | |||
| Method | RNAi |
