WormBase Tree Display for RNAi: WBRNAi00069903
expand all nodes | collapse all nodes | view schema
| WBRNAi00069903 | Homol | Homol_homol | F39H11:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atgcaaatgggtgatcatcaaatgatgggaaaccagagaacttacgttcaaaaagtgatgcctgcacaagctggtggtgcagtatcacaaaatgccacgtatgtgcaaacggcaggaattcgaacggttcatcacgacggaaacggacagcagaggatagttcaactacccccgggagtacgtcagattcagcaaaatggtgtcggtcctgcctatgttcgccaagttcctggtggtcaaccaatgcaagtaaactttggacatccaggaacgatagcgggtcgaaatgttgcagttggtgttcaaatgcgacctgtgcaaggacataacgttcaacaaggttatcagagacagcaagtagcaaatcaaattcaacaacaaaatcgagctgtatttatggcacaaaatcagcaaggacaacaacagataagctatgcgcaagcacaacatcgacaacaacaacagaatcaacaacaacaccaccagcaaccacaacattttaatcatccttctcaacaaaatcaaatgattatgcaacatcgtcaaccacaaatgcaccataatcagcaacatcaaatggttcaaccacaaatgacacgtcatcagatggcccaacaccatgctcagcagccacatccgcagatttatgtgccgcgtgacatgaatttggcagtgccactgagagaaccctcacctgagccgattcctgtcaaaattgaggttccagatgttcctccagaaggtacatcggctgccaatgaggaaccaatgccagatgat | |||
| Experiment | Date | 06 Jul 2000 00:00:00 | |||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F39H11.2a | Inferred_automatically | RNAi_primary | |
| F39H11.2b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00006577 | Inferred_automatically | RNAi_primary | ||
| Transcript | F39H11.2a.1 | Inferred_automatically | RNAi_primary | ||
| F39H11.2b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004352 | ||||
| Phenotype | WBPhenotype:0000047 | Remark | E lineage division defects | ||
| WBPhenotype:0000114 | Remark | Zygotic transcription was affected. tlf-1 RNAi leads to either derepression or to absence of endogenous gene expression. | |||
| WBPhenotype:0000834 | Remark | first two daughters generated by the E lineage (Ea and Ep) failed to ingress toward the interior of the embryo at the onset of gastrulation | |||
| Method | RNAi |
