Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for RNAi: WBRNAi00069901

expand all nodes | collapse all nodes | view schema

Name Class

WBRNAi00069901HomolHomol_homolF39H11:RNAi
Sequence_infoDNA_textatgcaaatgggtgatcatcaaatgatgggaaaccagagaacttacgttcaaaaagtgatgcctgcacaagctggtggtgcagtatcacaaaatgccacgtatgtgcaaacggcaggaattcgaacggttcatcacgacggaaacggacagcagaggatagttcaactacccccgggagtacgtcagattcagcaaaatggtgtcggtcctgcctatgttcgccaagttcctggtggtcaaccaatgcaagtaaactttggacatccaggaacgatagcgggtcgaaatgttgcagttggtgttcaaatgcgacctgtgcaaggacataacgttcaacaaggttatcagagacagcaagtagcaaatcaaattcaacaacaaaatcgagctgtatttatggcacaaaatcagcaaggacaacaacagataagctatgcgcaagcacaacatcgacaacaacaacagaatcaacaacaacaccaccagcaaccacaacattttaatcatccttctcaacaaaatcaaatgattatgcaacatcgtcaaccacaaatgcaccataatcagcaacatcaaatggttcaaccacaaatgacacgtcatcagatggcccaacaccatgctcagcagccacatccgcagatttatgtgccgcgtgacatgaatttggcagtgccactgagagaaccctcacctgagccgattcctgtcaaaattgaggttccagatgttcctccagaaggtacatcggctgccaatgaggaaccaatgccagatgat
ExperimentDate06 Jul 2000 00:00:00
Delivered_byInjection
InhibitsPredicted_gene (2)
GeneWBGene00006577Inferred_automaticallyRNAi_primary
TranscriptF39H11.2a.1Inferred_automaticallyRNAi_primary
F39H11.2b.1Inferred_automaticallyRNAi_primary
SpeciesCaenorhabditis elegans
ReferenceWBPaper00004352
PhenotypeWBPhenotype:0000051RemarkAuthors differentiate 3 classes of arrest: S1, S2 and S3. S1 embryos arrested at a very early stage (3080 cells), in which most of the markers that we tested were expressed prematurely and ectopically. S2 embryos arrested at an intermediate stage (150350 cells) with almost no detectable gene expression. S3 embryos arrested at a late stage (600800 cells) without any morphogenesis and with aberrant gene expression.
WBPhenotype:0000779RemarkAuthors differentiate 3 classes of arrest: S1, S2 and S3. S1 embryos arrested at a very early stage (3080 cells), in which most of the markers that we tested were expressed prematurely and ectopically. S2 embryos arrested at an intermediate stage (150350 cells) with almost no detectable gene expression. S3 embryos arrested at a late stage (600800 cells) without any morphogenesis and with aberrant gene expression.
WBPhenotype:0001100RemarkAuthors differentiate 3 classes of arrest: S1, S2 and S3. S1 embryos arrested at a very early stage (3080 cells), in which most of the markers that we tested were expressed prematurely and ectopically. S2 embryos arrested at an intermediate stage (150350 cells) with almost no detectable gene expression. S3 embryos arrested at a late stage (600800 cells) without any morphogenesis and with aberrant gene expression.
MethodRNAi