WormBase Tree Display for RNAi: WBRNAi00065618
expand all nodes | collapse all nodes | view schema
WBRNAi00065618 | Homol | Homol_homol | T23G7:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | taaattgccagaacaatcaggaaaatctcttgagagaagaacttgatccattcgtttctgacttggaagtaatccaagtgcatctctttcatcttgaatttgtggaacacttcgaattgcttctcttcctggaactgttctcgtttcatctacccagactgcggattcttcaagtggtccgatttgagtaatgaagacacgaaatttgacattcgaagagccttttccaccggattttgtcgctattcgtacttcaccgggaccacgtgatgctgcaccaactcgggcaataatttttgatggggatttccatctgaaaattgagcttcgagatgtaaattaaaagaattcgaatactcacttcatactccacaaactgtcgattccacatataaaaagcataatcac | yk52b9 | ||
Experiment | Laboratory | GS | |||
Date | 25 May 2001 00:00:00 | ||||
Genotype | dpy-20(e1282); arIs37[pmyo-3::ssGFP] | ||||
Temperature | 20 | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | T23G7.4 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00004752 | Inferred_automatically | RNAi_primary | ||
Transcript | T23G7.4.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004883 | ||||
Phenotype | WBPhenotype:0001426 | ||||
WBPhenotype:0001428 | |||||
Remark | Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | ||||
Method | RNAi |