WormBase Tree Display for RNAi: WBRNAi00064854
expand all nodes | collapse all nodes | view schema
| WBRNAi00064854 | Homol | Homol_homol | T05A6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gtttcctcactcttttcaaatgtcttctgctcgtcgttgccttttcggtcgtccgacgcccgagcaacgctccaggactcgaatttggcttgaagatgctgttaagcgcatgcgccaggaagaaagccagaaatggggattcgactttgaactggagactcccctcccaagctctgctggattcgtttatgaagttattccagagaattgtgttccggagttctacagaaccaaagttctcactgtcagaaccacatgctcatcgctggacatcagctcaacgactttgactccattgagctctccgagcacatctgataaggaggagccctcgctgatggatcccaacagctcgttcgaagatgaagaggaaccgaagaagtggcaattcagagagccaccaactccacggaagaccccaacaaagcgtcagcagaagatgaccgacttcatggcagtttcccgtaagaagaattcgttgtctccaaacaagctgtctccggtgaatgtgatcttcactccaaaatctcgtcgtccaacgatcagaactcgatcttcatgctctccatactagaggtttcattttgacttttttttgcccaattccacgggttgaatctaatcatttgattatctcctcgacagtttctgagtctctcttaattgttcaactagtcatgtttccacaaatgttttattgtttgttccaaaagccctgtgatccatgtttaggaactctgtaactcttttttcccattgccatttgttttaaacaactcaaagaaaaataaaccctttgaaatt | |||
| Experiment | Laboratory | VT | |||
| Date | 25 Aug 1998 00:00:00 | ||||
| Genotype | daf-7(e1372ts); rnr::GFP | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | T05A6.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000516 | Inferred_automatically | RNAi_primary | ||
| Transcript | T05A6.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00003201 | ||||
| Phenotype | WBPhenotype:0000202 | Remark | formation of the lateral alae characteristic of dauer larva cuticle was blocked or severely impaired | ||
| WBPhenotype:0000308 | Remark | in daf-7(e1372ts); cki-1(RNAi) dauer larvae, cell division, accompanied by rnr::GFP expression, was observed in the hypodermal and gonadal cell lineages | |||
| Method | RNAi |
