WormBase Tree Display for RNAi: WBRNAi00064853
expand all nodes | collapse all nodes | view schema
| WBRNAi00064853 | Homol | Homol_homol | T05A6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gtttcctcactcttttcaaatgtcttctgctcgtcgttgccttttcggtcgtccgacgcccgagcaacgctccaggactcgaatttggcttgaagatgctgttaagcgcatgcgccaggaagaaagccagaaatggggattcgactttgaactggagactcccctcccaagctctgctggattcgtttatgaagttattccagagaattgtgttccggagttctacagaaccaaagttctcactgtcagaaccacatgctcatcgctggacatcagctcaacgactttgactccattgagctctccgagcacatctgataaggaggagccctcgctgatggatcccaacagctcgttcgaagatgaagaggaaccgaagaagtggcaattcagagagccaccaactccacggaagaccccaacaaagcgtcagcagaagatgaccgacttcatggcagtttcccgtaagaagaattcgttgtctccaaacaagctgtctccggtgaatgtgatcttcactccaaaatctcgtcgtccaacgatcagaactcgatcttcatgctctccatactagaggtttcattttgacttttttttgcccaattccacgggttgaatctaatcatttgattatctcctcgacagtttctgagtctctcttaattgttcaactagtcatgtttccacaaatgttttattgtttgttccaaaagccctgtgatccatgtttaggaactctgtaactcttttttcccattgccatttgttttaaacaactcaaagaaaaataaaccctttgaaatt | |||
| Experiment | Laboratory | VT | |||
| Date | 25 Aug 1998 00:00:00 | ||||
| Genotype | rnr::GFP | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | T05A6.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000516 | Inferred_automatically | RNAi_primary | ||
| Transcript | T05A6.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00003201 | ||||
| Phenotype | WBPhenotype:0000740 | Remark | abnormal cell cycle arrest in starved L1 animals as cki-1 is required to maintain cells in a cytostatic state at the end of embryogenesis until the hatched L1 begins to feed. This was shown by rnr::GFP expression | ||
| Method | RNAi |
