WormBase Tree Display for RNAi: WBRNAi00064851
expand all nodes | collapse all nodes | view schema
| WBRNAi00064851 | Homol | Homol_homol | T05A6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gtttcctcactcttttcaaatgtcttctgctcgtcgttgccttttcggtcgtccgacgcccgagcaacgctccaggactcgaatttggcttgaagatgctgttaagcgcatgcgccaggaagaaagccagaaatggggattcgactttgaactggagactcccctcccaagctctgctggattcgtttatgaagttattccagagaattgtgttccggagttctacagaaccaaagttctcactgtcagaaccacatgctcatcgctggacatcagctcaacgactttgactccattgagctctccgagcacatctgataaggaggagccctcgctgatggatcccaacagctcgttcgaagatgaagaggaaccgaagaagtggcaattcagagagccaccaactccacggaagaccccaacaaagcgtcagcagaagatgaccgacttcatggcagtttcccgtaagaagaattcgttgtctccaaacaagctgtctccggtgaatgtgatcttcactccaaaatctcgtcgtccaacgatcagaactcgatcttcatgctctccatactagaggtttcattttgacttttttttgcccaattccacgggttgaatctaatcatttgattatctcctcgacagtttctgagtctctcttaattgttcaactagtcatgtttccacaaatgttttattgtttgttccaaaagccctgtgatccatgtttaggaactctgtaactcttttttcccattgccatttgttttaaacaactcaaagaaaaataaaccctttgaaatt | |||
| Experiment | Laboratory | VT | |||
| Date | 25 Aug 1998 00:00:00 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | T05A6.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000516 | Inferred_automatically | RNAi_primary | ||
| Transcript | T05A6.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00003201 | ||||
| Phenotype | WBPhenotype:0000358 | Remark | animals show extra lateral hypodermal cell divisions in the early larval stages | ||
| WBPhenotype:0000535 | |||||
| WBPhenotype:0000643 | |||||
| WBPhenotype:0000746 | Remark | misregulated cell division in numerous postembryonic cell lineages | |||
| WBPhenotype:0000755 | Remark | alterations in the timing of the L1 molt | |||
| Method | RNAi |
