WormBase Tree Display for RNAi: WBRNAi00063695
expand all nodes | collapse all nodes | view schema
WBRNAi00063695 | Homol | Homol_homol | CHROMOSOME_X:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | gaagagataatgctaggcgaggattttaggcatcaaccttgaatagacttgggtctatttgcggaattgacgggctctgtgttcctccattgcacaaattttgtggtagatttggaagtattccggtaaagccggctggtccaagaagagccaagtatctcttccaaactagatcaacgttcactggtggggtggccggcgcgactctgaagcaagatcaagatatcatatattattaaaaagtattcaacaacttatgttttatcaactcttgtaatgtcatccgtataacctatatgatctttacctgttaggccgtccctcgcgaagcgtccagttgcgaacctttgcattattcttcaaatgacttagaataagctttgctttactcagctggctt | |||
Experiment | Laboratory | GS | |||
Date | 01 Oct 2003 00:00:00 | ||||
Genotype | lin-12(n302) | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | K04G11.2 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00004764 | Inferred_automatically | RNAi_primary | ||
Transcript | K04G11.2.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00006438 | ||||
Phenotype_not_observed | WBPhenotype:0000006 | Remark | RNAi suppressed the no Anchor Cell-Egl phenotype of lin-12(n302). | ||
WBPhenotype:0000216 | Remark | RNAi suppressed the no Anchor Cell-Egl phenotype of lin-12(n302). | |||
Method | RNAi |