WormBase Tree Display for RNAi: WBRNAi00063351
expand all nodes | collapse all nodes | view schema
WBRNAi00063351 | Homol | Homol_homol | K04E7:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | gggaaattttatctatcaaaaaaaaaggcgacaagagtaaatttcagagtttttgatcgaaaatcgacagaacgagtttttcaggcaaaacatcatacggccatgaactcgaaacagtaccactaccggaaaagaaaatctacacaacatggcctgatatgatcaggcattggcctaaaacaacactgtgcatcgtgtccaacgaattctgcgaacgattctcatactatggaatgagaagtgagttgctttatttgttagggtaaaagtgtaaaggatataatagatcctttaaacagccttaaacatttctgatgtatcaataatctacaaaaaatatttttatttgtacatatatttttagtttagtttaagaggtaaggtgaagaaaaagtagagttaaaccttattttgattttcggccggtgggtggacattttcagataagggtattatcaacatttactttaagtacatggtactcaaaaagtgaatttcctatctacatgccagtatatttaaaaatcgaaagttttgacacatgaaatgcaaataagacattttttcaccgatatcactaaaaggtcataatccggttattaccataatgattatgacgttggcagtacagaagatcaattgaaacgtgacacgaaaaatttgcagcggtcttgacattctacctgctt | |||
Experiment | Laboratory | KWN | |||
Date | 18 Aug 2003 00:00:00 | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | K04E7.2 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00003877 | Inferred_automatically | RNAi_primary | ||
Transcript | K04E7.2.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00006186 | ||||
Phenotype | WBPhenotype:0000031 | Remark | slow growth and thinner animals | ||
WBPhenotype:0000039 | Remark | authors note a slight increase that could be due to the slow growth phenotype | |||
WBPhenotype:0000154 | |||||
WBPhenotype:0001010 | |||||
WBPhenotype:0001183 | Remark | RNAi animals show a decrease in fat content as assayed by nile red staining | |||
Method | RNAi |