WormBase Tree Display for RNAi: WBRNAi00063112
expand all nodes | collapse all nodes | view schema
| WBRNAi00063112 | Homol | Homol_homol | W10G6:RNAi | ||
|---|---|---|---|---|---|
| CHROMOSOME_X:RNAi | |||||
| Sequence_info | DNA_text | ccagattcctaccgcagctccattacttctcggccagctttcaaccgtaccgtcacaagtagtactcaaaactacggaacaccagcatctggaaatcgtgtgctcaaaattgtcaccgaaacacacacctcctcagttgcgagtggactttccccatatggccaaggcgctgcttccaccatccgcgatgaccgcgaacgtgagaagaaggaaatcacggagctcaacgatcgtttggctagctatattggaaaagttagatttctagctgctcaaaacagaaagttggaggccgatttaaatgtgctccaatcgagatttggaaagagtactggatctgtaaagattatgtatgagatggagatcactactgccacaaatgttgtcaaggaaacaggaaaggaccatgaagaggctgagaaggaaattggcaagattaaagatcagctcgatgagttacgcaaaaagtttgaagaggctcaaaagggacgtgcagaagatcgtttaaaaattgatgagcttcttg | |||
| Experiment | Laboratory | CZ | |||
| Date | 11 Nov 2003 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F52E10.5 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00002051 | Inferred_automatically | RNAi_primary | ||
| Transcript | F52E10.5.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00006428 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | arrest at the 2-fold stage of elongation with constrictions of the epidermis | ||
| Penetrance | Range | 86 | |||
| WBPhenotype:0000054 | Penetrance | Range | 13 | ||
| WBPhenotype:0000475 | |||||
| Remark | similar results obtained in the rrf-3 background | ||||
| Method | RNAi |
