WormBase Tree Display for RNAi: WBRNAi00063098
expand all nodes | collapse all nodes | view schema
| WBRNAi00063098 | Homol | Homol_homol | T05G5:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | cttttattatgaaattgtatataaatgcaattattccttggtagaaatcttgtatccgagaatagcctcctctccgcaggcagcaacgacttgaacctgaaaatcaaaattttcagattcaaaaggtggatgtcgaaataattaccaagacgcttccttcgtctttctcgagagcctcacggatagtgtttcccaagtctccttctggcattttgagatcgtctttgagctcgcaagattctggatccatgagcgagcagaacccgtcttcgatcgacatgagctgaaaatttgatcaataacattttttacagctgattaactcatttttcaaaagatttgtttaaccgtccaaagttgatttttttgaaagccttcttaaaaactaattaacaacttacaatgtactcgcgtctcttgacgactgggacgtccatgttgtgggtggatgggcagatatcctcaagcttcttggtggtgaaaatatcgatggcaaccatgtgaaccttagcatgtccgtgctttccagtcttggaggtgctcatctcgacgatctaaaaaatttctaattaggaaaattcactgaattattttttaccttgcatggtcttcctcggatcatgacgtgctcgttcttgcgaagagccgagcattgcttcggg | yk445a8 | ||
| Sequence | yk445a8 | ||||
| Experiment | Laboratory | JN | |||
| Date | 02 Feb 2004 00:00:00 | ||||
| Genotype | vit-2::gfp | ||||
| Inhibits | Predicted_gene | T05G5.10c | Inferred_automatically | RNAi_primary | |
| T05G5.10a | Inferred_automatically | RNAi_primary | |||
| T05G5.10b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002064 | Inferred_automatically | RNAi_primary | ||
| WBGene00271656 | Inferred_automatically | RNAi_primary | |||
| Transcript | T05G5.10a.1 | Inferred_automatically | RNAi_primary | ||
| T05G5.10b.1 | Inferred_automatically | RNAi_primary | |||
| T05G5.10c.1 | Inferred_automatically | RNAi_primary | |||
| T05G5.17 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00006466 | ||||
| Phenotype | WBPhenotype:0000291 | Remark | mature oocytes are not generated | ||
| Remark | authors note that RNAi was applied to worms either by soaking or feeding, but do specify which method was used in this experiment | ||||
| Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
| Method | RNAi |
