WormBase Tree Display for RNAi: WBRNAi00063062
expand all nodes | collapse all nodes | view schema
| WBRNAi00063062 | Homol | Homol_homol | T05A6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | cttttcaaatgtcttctgctcgtcgttgccttttcggtcgtccgacgcccgagcaacgctccaggactcgaatttggcttgaagatgctgttaagcgcatgcgccaggaagaaagccagaaatggggattcgactttgaactggagactcccctcccaagctctgctggattcgtttatgaagttattccagagaattgtgttccggagttctacaggtaattgaattttataaatttttcatagttattttactaaacagtttcatttttcagaaccaaagttctcactgtcagaaccacatgctcatcgctggacatcagctcaacgactttgactccattgagctctccgagcacatctgataaggaggagccctcgctgatggatcccaacagctcgttcgaagatgaagaggaaccgaagaagtggcaattcagagagccaccaactccacggaagaccccaacaaagcgtcagcagaagatgaccgacttcatggcagtttcccgtaagaagaattcgttgtctccaaacaagctgtctccggtgaatgtgatcttcactccaaaatctcgtcgtccaacgatcagaactcgatcttcatgctctccatactagaggtttcattttgacttttttttgcccaattccacgggttgaatctaatcatttgattatctcctcgacagtttctgagtctctcttaattgttcaactagtcatgtttccacaaatgttttattgtttgttccaaaagccctgtgatccatgtttaggaactctgtaac | yk390e10 | ||
| Experiment | Laboratory | JR | |||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | T05A6.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000516 | Inferred_automatically | RNAi_primary | ||
| Transcript | T05A6.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00006027 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | Emb among F1 progeny laid within 15 hours after injection. Most severely affected embryos arrest with many cell corpses and without elongating or undergoing pharynx morphogenesis or differentiation. | ||
| Penetrance | Range | 32 | |||
| WBPhenotype:0000749 | Remark | embryonic hyperplasia | |||
| Remark | Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | ||||
| Method | RNAi |
