WormBase Tree Display for RNAi: WBRNAi00063056
expand all nodes | collapse all nodes | view schema
| WBRNAi00063056 | Homol | Homol_homol | Y102A5C:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggaagactcgtacaacgacatggaagaccccggcttccgccaattatctgacatggagcttcaaaaagcgctggaaatgaccaaacagagctcgataaagaacaatttgatgctcgggctcgacaatgagcttgactttgattttgatttcgacgaggatgaggacctggatcaaccacaaatgggcacacgagccgataaatcgttgggattgttggcgaaacgatttattcgaatgattcagtactcaccgtatggaagatgcgatttgaacactgccgccgaggcgctcaatgtccggcaaaagcgacgaatctacgatattacgaatgttctcgaaggaattggtcttattgagaaaagaagcaagaatatgatacagtggaa | |||
| Experiment | Date | 24 Apr 2003 00:00:00 | |||
| Genotype | ubc-18 (ku354) | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | Y102A5C.18 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001161 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y102A5C.18.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005931 | ||||
| Phenotype_not_observed | WBPhenotype:0001748 | Remark | One out of 245 animals with the pharynx unattached (basically non-Pun). | ||
| Method | RNAi |
