WormBase Tree Display for RNAi: WBRNAi00062949
expand all nodes | collapse all nodes | view schema
| WBRNAi00062949 | Homol | Homol_homol | C29E4:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | attgctgtgggaggcgagaatcgattgagattgaaaacatttattgctggaagaaatcgtttggaaaatccaggagcacatgcactggcggctacttttaaggctcttgaaacggttgaatggtttgatgttcgtcaaaatggaattcatgaagaaggaattcgtgctctggtggctgcattgaaacacaacagaaatcttcgatatctctggcttgaagacaatacagtactccccaagggtgcaaaggctcttgcaaaaactctggaatcttggccgaagttagaagttttgaatttgtcagactgtttgattcgtgacgctggatgcaattacattattgatcacttgaatcctcaacatcatcgccatcttaaaaatgtttacctttgcggaaacgagctcacaccacccgtcgctaagctcctgattcaaaaatggtcaaagtttgatggtcttacaccgaaaccagtgcttcatattcataccaattcgtttggtgatgaattctctgatgttgctggaatggcaccggaaaatgtgaatgttggagatgaagatgatgatttgggaagtttggatggagatcaagaggagtacaatagtaaatcgtcagattcggaagatgcagatttggatgatgacgatgaagatgatgatgaggaagcggagattcagattatcgacaatggagaatcacagttaaaacttgcaatggatcgaattgatcgtct | |||
| Experiment | Date | 23 Aug 2002 00:00:00 | |||
| Genotype | GFP::histone H2B | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | C29E4.3b | Inferred_automatically | RNAi_primary | |
| C29E4.3a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004303 | Inferred_automatically | RNAi_primary | ||
| Transcript | C29E4.3a.1 | Inferred_automatically | RNAi_primary | ||
| C29E4.3b.1 | Inferred_automatically | RNAi_primary | |||
| C29E4.3b.2 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00005637 | ||||
| Phenotype | WBPhenotype:0000363 | Remark | division of P1 is often delayed, which leads to prolonged appearance of three-cell-stage embryos | ||
| WBPhenotype:0001102 | Remark | spindles were never assembled in embryos | |||
| WBPhenotype:0001348 | Remark | abnormal chromatin morphology | |||
| WBPhenotype:0001580 | Remark | nuclear envelope formation is disrupted | |||
| Remark | an antibody (mAb414) was used to score the nuclear envelope | ||||
| Method | RNAi |
