WormBase Tree Display for RNAi: WBRNAi00062925
expand all nodes | collapse all nodes | view schema
| WBRNAi00062925 | Homol | Homol_homol | Y39G8C:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | caagccgaaggatacgtgcgggctattcaatggaacctccactactactatcatggatgcgtctcgtggagctggttctacccgcatcactatgctccgttcatctccgatgttcgcggattcgtgggcatgcggatggagttcgagctctccgagccattccacccgtttgagcagttgctcgccgtgctgccagaagcgtcggccgactgtctaccacgtccacttcgcgagctgatgtcgtcggatcctgcgaaatcgccgatttgcgacttttatccggccaactttgagacggacctgaacgggaagcgcaacgagtgggaagcggtggtgctgatcccgtttatcgaggagaagcggcttctggaggcgattgaggcgaaacggagccgcttgacgagtgaggaaaatgctcggaattctcatggatctcatattcagtgtatatcatcaccagagccgccaaatagccaaggccaatggcgaactgttcgttctgaaatcccacaagattcgttcaggattccaagatcccaagtcaagtggggactcttacccaatgtgaaaatggatgtgtacttcccgggatttccgacgatgaagcatttgagccatctcggagagctgcgattcgcgaattgcaatatttttggaatggcgtcgcgaaaggagtcgatggtgttgaag | |||
| Experiment | Laboratory | AW | |||
| Date | 22 Nov 2003 00:00:00 | ||||
| Genotype | histoneH2B::GFP | ||||
| Treatment | authors co-injected double-stranded xrn-1 RNA with double-stranded GFP RNA into histone::GFP hermaphodites | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | Y39G8C.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00012730 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y39G8C.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00006308 | ||||
| Phenotype | WBPhenotype:0000743 | Remark | animals with weak fluorescence, which is indicative of reduced efficiency of RNA interference | ||
| Remark | Injection of double-stranded GFP RNA into wildtype embryos completely silences the histone::GFP expression after 48 h. | ||||
| Method | RNAi |
