WormBase Tree Display for RNAi: WBRNAi00062856
expand all nodes | collapse all nodes | view schema
| WBRNAi00062856 | Homol | Homol_homol | F57B1:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ttttgttccaacgtgggcccagtttaaacgtactcttatggctgttgttctttttgctatgttatacaagtatgctcgtgattgtttattcgatggaacgcatcataattcagaaggatcctacgcggataaagacgcgaattgggcgtccgaaaaacagaaatttcatcagacgatttccaatctccgagcagagttttcggcgcacgataaacaactcgatttcaaaactgaccatttggaaaaactactggaaaacgttttggaacacagcaaaggatggaaagagtcggcaatcgaagagctcaaacagatcaaattatggcaagcagaaattagcgatgctttgcaacaaatgaaaaaggaaatcgatgatgcgaaaagcacaaagatcatccacagtacaccagaaaaggctcc | |||
| Experiment | Laboratory | TG | |||
| Date | 22 Mar 2004 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | F57B1.2 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00006311 | Inferred_automatically | RNAi_primary | ||
| Transcript | F57B1.2.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00006526 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | embryos die around the 300-cell stage with defects in nuclear structure, DNA content, and chromatin morphology | ||
| Remark | to determine phenotypes associated with Emb, the authors used DAPI staining and thin-section TEM | ||||
| Method | RNAi |
