WormBase Tree Display for RNAi: WBRNAi00061424
expand all nodes | collapse all nodes | view schema
| WBRNAi00061424 | Homol | Homol_homol | R151:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gttggtagcatgggatcgtaagagagatagtgtgctgaatccagaagagcagggaaaattctttcaaggagatattgttctctatccagagcaagcaaaggctctttatgagcaagcactaactgaaggttggtataatattagcgcaccacatttcattttaaaatgtaccaccaaaatttgaaatttaaatttttaagaggcctttttttggtttgcaaaaaatattaaagaatgaatttcaggaaaaacaagagtaaagagaaaattcattgggtctaacttgagaagatgggacgccagtcgaccgataatttatgcttttgatggaagtcacagtgagttttcaagcataaaactgttttatttaagatgtcatcaagtgtggattaagtctaaacgca | |||
| Experiment | Laboratory | CB | |||
| Date | 18 Jun 2004 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | R151.5a | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00006592 | Inferred_automatically | RNAi_primary | ||
| Transcript | R151.5b | Inferred_automatically | RNAi_primary | ||
| R151.5a.2 | Inferred_automatically | RNAi_primary | |||
| R151.5a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00024637 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | inefficient and poorly penetrant phenocopy of the dpy-31 mutant phenotype | ||
| Penetrance | Range | 5 | |||
| Method | RNAi |
