WormBase Tree Display for RNAi: WBRNAi00061180
expand all nodes | collapse all nodes | view schema
| WBRNAi00061180 | Homol | Homol_homol | R13F6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gagttcaccccagtctgagtctccatgatgcactttttccaattcgtgctgacaggattcgtgactcaaaaagccctactcatattgtagaagaatttgggtcacgaagtcgacgtagcctcggagcttcatcgtctcgacatcgaaacattgaaattctgtccccacgaagtgccacgtttgaacaattcgttcttgaaggacgtcactatctgacatttatcaacgaacgaagccgagttgaaccaatttcattcgttgccgaagaacttcaacgcccaacaactcctccgaaaacttcctcatctggaacctcaggagcaaaagagcatccattagcatcagttcttgtatgtgaatccaactgtaatcaacgtggagaatgtgttcatggaaagtgtcattgtgctcctggtttcacgggccgaacttgcgatgaagctgtatgtccagtcgtttgcagtggaaatggagtcttctctggtggaatttgcgtttgcaagtctggattcaaaggaaaggaatgtgagatgcggcacaattggtgtgaagtagcagactgtaatggaaggggacgatgtgacactgacggaagatgccgttgtaatcctggatggactggtgaagcttgcgagcttcgtgcatgtccacatgcatcgtgccacgatcgaggtgtttgtgtgaatggaacatgctattgtatggatggatggagaggaaatgattgttcagtttttgctgatgcaattgtacatgtcccacaagcacagtctccaccgagaagaggtcaagagccaacggaatcatctaaaactcggaaggctcaagtgaaaccgactccaacttctgagaagaagaaagaaagccgagagcttcaaaaaccaataattgccacagttcaagttcctacagaatcaagccatccgtgctcagctcatggtcaactgattgatgacatatgtcagtgtgagtcaggttgggattcggtagactgttctcaacaagcatgtcaatgtgttaatggagactgtcttgatgatggatcatgtcaatgttggaaaggatggagaggatctaactgcacagataagaaatgtgcgattggatgtgaagatcgtggaaaatgtgcatcggatggatcat | |||
| Experiment | Laboratory | RU | |||
| Date | 18 Feb 2005 00:00:00 | ||||
| Genotype | ten-1a::GFP, rrf-3(pk1426) | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | R13F6.4a | Inferred_automatically | RNAi_primary | |
| R13F6.4d | Inferred_automatically | RNAi_primary | |||
| R13F6.4e | Inferred_automatically | RNAi_primary | |||
| R13F6.4f | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00006498 | Inferred_automatically | RNAi_primary | ||
| Transcript | R13F6.4f.1 | Inferred_automatically | RNAi_primary | ||
| R13F6.4e.1 | Inferred_automatically | RNAi_primary | |||
| R13F6.4a.1 | Inferred_automatically | RNAi_primary | |||
| R13F6.4a.2 | Inferred_automatically | RNAi_primary | |||
| R13F6.4d.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00025239 | ||||
| Phenotype | WBPhenotype:0000038 | Remark | worms often burst through the vulva | ||
| WBPhenotype:0000474 | Remark | Vulva muscles were often mispositioned or they did not attach to the body wall or to the vulva. | |||
| WBPhenotype:0000603 | Remark | Vulva muscles were often mispositioned or they did not attach to the body wall or to the vulva. | |||
| WBPhenotype:0000691 | Remark | In more severe cases, somatic gonad cells did not envelop the gonad and often remained as an isolated group of cells germ cells spread throughout the body cavity and no mature oocytes and sperm developed | |||
| Method | RNAi |
