WormBase Tree Display for RNAi: WBRNAi00059926
expand all nodes | collapse all nodes | view schema
| WBRNAi00059926 | Homol | Homol_homol | B0464:RNAi | |||
|---|---|---|---|---|---|---|
| Sequence_info | DNA_text | gtcgacttctgttaagcatcgtgagttcgtcggagagccaatgggcgacaaagaagtcacatgcatcgccgggatcgggccaacatatggcaccaagctcaccgatgcaggcttcgataaagtatgtagatttttttttctcaaattttcgatcaatgttaaaatttgaatttcaggcctacgtactgttcggacagtatctccttctgaagaaagacgaggatttgtttatcgaatggctgaaagagacggctggagtgactgcaaatcacgcgaagacggcgttcaattgtttgaacgagtgggcagatcagttcatgtaaactgctcaatatttctgctaagcatcgatttgattctcctctataatcatcaatggccatatttgcacttcgaaaaacaccatttgttccagtgtagtcgttttccgctttgcgactatgccccatttcaaattaatctgtttctgaaatatttctcatacttccaagttttcccccttgtcgtgtggtcttggac | yk333d11 | |||
| Experiment | Laboratory | KM | ||||
| Date | 01 Aug 2000 00:00:00 | |||||
| Delivered_by | Injection | |||||
| Inhibits | Predicted_gene | B0464.7 | Inferred_automatically | RNAi_primary | ||
| Gene | WBGene00000235 | Inferred_automatically | RNAi_primary | |||
| Transcript | B0464.7.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | |||||
| Reference | WBPaper00004269 | |||||
| Phenotype | WBPhenotype:0000050 | Remark | baf-1(RNAi) embryos arrest development at an early stage (less than 100 cells) with near 100% penetrance. Arrested embryos display defects in chromosome segregation during mitosis, although spindle assembly appears normal. | |||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | |||
| Remark | Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
| Method | RNAi |
