WormBase Tree Display for RNAi: WBRNAi00022660
expand all nodes | collapse all nodes | view schema
| WBRNAi00022660 | History_name | JN:yk545e9 | |||
|---|---|---|---|---|---|
| Homol | Homol_homol | C04G2:RNAi | |||
| Sequence_info | DNA_text | cgagcgtttgaccttctgttggcttctgctgcgactacgtctcttggcaggagtcttctttgcagtcgaagcacgacgtccacgagccttcaaggatgagcggcgacgagagcggcgacgagagcttctgcgagacccggaacgggagcgtgaataagagcgacttctggagcggcttctggagcggcttctggagcgagaacgcttcgacgagcgagagcgtcctgtgcgtccatacaccgatccacgagaagacgaacggcggctcacggatccacgggatgcgcttctcacaaccgatcgacgagacgaacggctggttgatgaacgacgacgacgtggtgatggagagatcacaacaaccaagctgaaaaggaaaaatatttgcgatgaaaagataatatatttctgcttaccttggcgatttggcagtgtgcgttgagaccgaacggactgagattctgcgactcgctggtctcccaacactacggcttcgacgagcacgagatgcgcttctggagcgggagcggctcacgacggtcctcttggtcttggcaagaggagtgaagcgtccttttgagtcacgaggacgaagtttgttcttctgactcttcgacttcggcatttgcggatgatttttgatggtctatttagtagacgagacgagtgttatactgattttaacagaaaat | yk545e9 | ||
| Sequence | yk545e9 | ||||
| Experiment | Laboratory | JN | |||
| YK | |||||
| Date | 17 Jul 2001 00:00:00 | ||||
| Genotype | [cgc4769]peIs1 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | C04G2.8 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00007307 | Inferred_automatically | RNAi_primary | ||
| Transcript | C04G2.8.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004769 | ||||
| Phenotype_not_observed | WBPhenotype:0000886 | ||||
| Remark | co-injectin of gfp dsRNA as a control | ||||
| Authors' Web Link-General (http: | |||||
| Authors' Web Link-Specific (http: | |||||
| Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
| Method | RNAi |
