WormBase Tree Display for RNAi: WBRNAi00002036
expand all nodes | collapse all nodes | view schema
WBRNAi00002036 | History_name | SA:yk368b2 | |||
---|---|---|---|---|---|
Homol | Homol_homol | C37A5:RNAi | |||
Sequence_info | DNA_text | atctttgtctcggtttccgaacgggtatcacggatttgcctgaaacttctaatagtacaaattaactagatttgctataaactcacggtgtctgggagttcatgttcatttcagtcttcacaccggatccttgcccatccatcttcatactggattgggtttccgagcgacgttcaagggtgtgcctgaaacttcggagcgtttaggtttactagttatggtaaaataaactcacggtgtctgggaattcatgttcatctccgtcttcacatccgatcccgatcctcccatcttcatcttggactcggtttctgttgcacagaatgctccgatcgccaggattgcaacaaggaatacagaaatgaacttcattgttagtaagtgctagatgacttgagaatttggagatcttggaagtggttttatagtgttacagaatactgtttttgtttttggtttagaaatatggt | yk368b2 | ||
Sequence | yk368b2 | ||||
Experiment | Laboratory (2) | ||||
Date | 06 Feb 2001 00:00:00 | ||||
Inhibits | Predicted_gene | C37A5.4 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00007990 | Inferred_automatically | RNAi_primary | ||
Transcript | C37A5.4.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004651 | ||||
Phenotype_not_observed (5) | |||||
Remark | yk368b2 | ||||
Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
Method | RNAi |