WormBase Tree Display for RNAi: WBRNAi00001969
expand all nodes | collapse all nodes | view schema
| WBRNAi00001969 | History_name | SA:yk363h11 | |||
|---|---|---|---|---|---|
| Homol | Homol_homol | T08A9:RNAi | |||
| Sequence_info | DNA_text | ttttaaaaatcgaaaatttattggtaaaagtttcaaacaagtaaaaatttcaatgatccgtttatgggcattcgttaagcttggtgcacacatcctttggagcggttcctccttccagctcgtgaatgattgggtctaccttgctgttgacgtaatgatcgcattctctggttccgaatgggatggtgtggaaaagcttcttgcattcagcatcgaaatcctagaatattcaagagttgttggtttttttctagcacggatttattaccttcttgatgacattggcatccttatcggcggatccttcgtatttcttgacaaccaactcacacatttgacagctcaatgcgcttctattttctgggatggcaagtcctgaggcaacggcgaccaaaacgg | yk363h11 | ||
| Sequence | yk363h11 | ||||
| Experiment | Laboratory | SA | |||
| YK | |||||
| Date | 06 Feb 2001 00:00:00 | ||||
| Inhibits | Predicted_gene | T08A9.9 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004990 | Inferred_automatically | RNAi_primary | ||
| Transcript | T08A9.9.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004651 | ||||
| Phenotype | WBPhenotype:0000059 | ||||
| Remark | yk363h11 | ||||
| L2 arrest | |||||
| Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
| Method | RNAi |
