WormBase Tree Display for RNAi: WBRNAi00001715
expand all nodes | collapse all nodes | view schema
| WBRNAi00001715 | History_name | SA:yk342d11 | |||
|---|---|---|---|---|---|
| Homol | Homol_homol | B0252:RNAi | |||
| Sequence_info | DNA_text | atagataaaattatgcaaaacatataatgttttttaatcagcagccatcggattcgcgtggatcgtcacattctgtattctgaatattagcaattaatgagagaatttagttttccgtagaaactcacttttgctgaacgagaggtctgtatttattgtcaactttgatcgtttctatttcttctagggtgtcgaatccgtcaatcactctgaaaattatgattgttgcgcaaataatcttaatggtaattccttactttccgaaaagtgtgtacttcatgtcgagatgagcttgcttcgcgtaagtgatgaagaattgcgatcgattggagtcaggtccattgtttgccattgatacgcatcctcgtgagtcatgctaaaaattgaactattttgaaactaagatttaaagtattccgttgtaccttcagagcactaacaaattcgtcttcgaatggtcctccccaaatactttcgccgccttttcccgaatgcgttggatctccagtttgcaccataaaatctttgatgtttctatgaaaaatgcatccattgtagtagtcgctggcacataatgcaagaaaattctgaaataaaatagaatttatattttttagcggttaagaagcataaactgaatttacctcgcaagcttttggcgcatcgtctacataaagctcaattttaatgtctcc | yk342d11 | ||
| Sequence | yk342d11 | ||||
| Experiment | Laboratory | SA | |||
| YK | |||||
| Date | 06 Feb 2001 00:00:00 | ||||
| Inhibits | Predicted_gene | B0252.4a | Inferred_automatically | RNAi_primary | |
| B0252.4b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00000886 | Inferred_automatically | RNAi_primary | ||
| Transcript | B0252.4a.1 | Inferred_automatically | RNAi_primary | ||
| B0252.4b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004651 | ||||
| Phenotype_not_observed | WBPhenotype:0000050 | ||||
| WBPhenotype:0000062 | |||||
| WBPhenotype:0000535 | |||||
| WBPhenotype:0000689 | |||||
| WBPhenotype:0000886 | |||||
| Remark | yk342d11 | ||||
| cyp-10 | |||||
| Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
| Method | RNAi |
