WormBase Tree Display for RNAi: WBRNAi00000400
expand all nodes | collapse all nodes | view schema
| WBRNAi00000400 | History_name | SA:yk190h5 | |||
|---|---|---|---|---|---|
| Homol | Homol_homol | F48G7:RNAi | |||
| Sequence_info | DNA_text | caaataatttaagcagaaatttcaaacatttaacaatatccgcaagtctttggacactggtctttcatcaatcccttgtacgtcggatcagtgcatagatacttcttttgcgggcaatcactaaccccagttctcgggtccactttatcagaacacgctggcgccttggtagtcgacccagtagtgcagaatccgcaagtcttagggcattgctcgtgcatcacctttctgtagttaggatccgtgcacaaattgcgtcgcattgggcaatcgctgactcctgtcgcagggtttaatttgtcttggcatggagcagcagtagtggttgttgatggggaaagtgtggtgccattgcccgatatgactggaaacaataaatttcagagtggtaggtataggttttgcagtgcccgcgcccgacacgacactgtgcaacttgtaagactagcgaagattgccgcaagccgtaacggtgcctacttgtagctctaattttgagttaactcactatagacgtcgtcatcggagcagcaaagcccaccgggcaattctgtgaactttggtggacatggattgacaccttttgcgaatggagtacttttgcagcctaactggatttccccgtttacccagaggatggcaagagtaagaagagcaactcgaagcatcatttgta | yk190h5 | ||
| Sequence | yk190h5 | ||||
| Experiment | Laboratory | SA | |||
| YK | |||||
| Date | 06 Feb 2001 00:00:00 | ||||
| Inhibits | Predicted_gene | F48G7.5 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00018616 | Inferred_automatically | RNAi_primary | ||
| Transcript | F48G7.5.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004651 | ||||
| Phenotype | WBPhenotype:0000032 | ||||
| WBPhenotype:0000689 | |||||
| WBPhenotype:0001037 | |||||
| Remark | yk190h5 | ||||
| P0 sterile,escapers: F1 sterile,unhealthy | |||||
| Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
| Method | RNAi |
