WormBase Tree Display for Construct: WBCnstr00041075
expand all nodes | collapse all nodes | view schema
| WBCnstr00041075 | Summary | [nhr-57p::nhr-57::gfp:: nhr-57 3'UTR, unc-119(+)] | |
|---|---|---|---|
| Driven_by_gene | WBGene00003647 | ||
| Gene | WBGene00003647 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [nhr-57p::nhr-57::gfp:: nhr-57 3'UTR, unc-119(+)] translational fusion. A 1,206-bp fragment upstream of the nhr-57 transcriptional start site was amplified together with the coding genomic region (without the stop codon) using the primers ctaacaacttggaaatgaaatCACCAA- CACCTTCTACACAGCTGC and gttcttctcctttactcatTTGTCCATCAA- TGATTTTATAGATTTTGTCG. The gfp sequence was amplified from pPD95.75 using the primers ATGAGTAAAGGAGAAGAAC and gagatctggttcaaatagCTATTTGTATAGTTCATCCATGC. 459 bp of the nhr-57 39 UTR were amplified using the primers GCTATTTGAACCAGATCTCTTC and cagtacggccgactagtagGAATAAATCATCCCAAAGCCGTTTTTG. A vector backbone containing a CB-unc-119(+) rescue as well as the AmpR gene was amplified using the primers ATTTCATTTCCAAGTTGTTAGCG and CTACTAGTCGGCCGTACTGAGGTGTTGTCGCTT-TTATTGGG. The four fragments were combined into a 10.170-kb plasmid (pSMa32) using Gibson Assembly. N2 animals were injected (because of mutation in the CB-unc-119(+) gene) with 5 ng/l pSMa32, 2.5 ng/l pCFJ104 and 100 ng/l pBS. Transformants were isolated based on the presence of the co-injection marker. | ||
| Used_for | Transgene_construct | WBTransgene00026321 | |
| Reference | WBPaper00056812 |
