WormBase Tree Display for Construct: WBCnstr00039206
expand all nodes | collapse all nodes | view schema
| WBCnstr00039206 | Summary | [Pselt-1.1::selt-1.1::gfp] | |
|---|---|---|---|
| Driven_by_gene | WBGene00007955 | ||
| Gene | WBGene00007955 | ||
| UTR_3 | WBGene00006789 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [Pselt-1.1::selt-1.1::gfp] translational fusion. Translational constructs Pselt-1.1::selt-1.1::gfp include promoter, exons and introns of the gene of interest in frame with the gfp coding sequence. The unc-54 3'UTR sequence provided by the vector was used. Forward primer:acggtcgacgttagggaatgaaaagttg; reverse primer:ggatccgacagtctgttggaactctccaaatg . The PCR products were cloned into the pPD95.77 vector. | ||
| Clone | pPD95.77 | ||
| Used_for | Transgene_construct | WBTransgene00032095 | |
| Reference | WBPaper00051003 |
