WormBase Tree Display for Construct: WBCnstr00021190

WBCnstr00021190 Public_name: cpFLIPPi-6.4m
  Summary: [Pgtl-1:FLIPPi-6.4m]
  Driven_by_gene: WBGene00001795
  Construction_summary: Construction of cpFLIPPi-6.4m was previously described. In brief, cpFLIPPi-6.4m is a chimeric protein in which the cyanobacterial Pi binding protein is sandwiched between eCFP and circular permuted Venus. The Kd for Pi binding to the purified sensor protein is 6.4 mM when assayed at pH 7.5. In this work, cpFLIPPi-6.4m was translationally fused to the first 91 amino acids of the beta integrin protein PAT-3. This region of PAT-3 targets cpFLIPPi-6.4m to the cytoplasmic side of the cell membrane, as well as labeling intracellular perinuclear membranes. The sensor was targeted to the cell membrane to minimize the effects of different promoters on protein accumulation and to restrict the sensor to the desired cells. This targeting also facilitated imaging because small amounts of the sensor were more readily detected when localized to specific regions of the cell. pPD122-39 (Addgene), a vector from the Fire plasmid collection [18], was used as thesource for the membrane targeting sequence. The plasmid contains the PAT-3 membranelocalization sequence (MLS) fused to GFP and the unc-54 3' UTR. The GFP sequence wasremoved from the plasmid using inverse PCR and the primers 5'-tagcattcgtagaattccaactgagcgccg and 5'-tttttctaccggtacctcggatctatcatgaag. A 2.6 kbBamH1-HindIII fragment containing cpFLIPPi-6.4m was cut from pRSET/cpFLIPPi-6.4m[11] and ligated to the GFP-deleted PAR-3 MLS plasmid. The gateway ATTR cassette C.1(Invitrogen, CA) was then ligated to a Sma1 site to create the destination plasmid pLR318. The1.6 kb ATTL-flanked intestinal gtl-1 promoter, contained in the plasmid pBL63 [19] was then recombined with pLR318, using LR clonase (Invitrogen) to generate the plasmid pLR316. The hsp-16 heat shock promoter was PCR-amplified from genomic DNA using the primers: 5'-ggggacaagtttgtacaaaaaagcaggcttaagcttgcatgcctgcagg and 5'-ggggaccactttgtacaagaaagctgggtgctagccaagggtcctcct. The 540 bp ATTB-flanked hsp-16 heat shock promoter was then recombined with the plasmid pDG15, using BP clonase (Invitrogen) to generate the plasmid pBL172. The ATTBL-flanked hsp-16 promoter in pBL172, was then recombined with pLR318, using LR clonase, to generate the plasmid pLR323. To determine how much 542 nm emission from cpFLIPPi-6.4m was due to direct excitation of cpVenus by the 445 nm laser, the eCFP sequence from pLR323 was removed using inverse PCR and the phosphorylated primers: 5'-gggatcggtaccgtaggatttctaacagcgacctcggctcaagccc and 5'-gcggcccggatctttttctaccggtacctcggatctatcatgaag. The plasmid was religated to generate pLR324.
  Used_for: Transgene_construct: WBTransgene00021524
  Reference: WBPaper00048692