WormBase Tree Display for Construct: WBCnstr00020480
expand all nodes | collapse all nodes | view schema
WBCnstr00020480 | Summary | [vha-6p::cav-2] | |
---|---|---|---|
Driven_by_gene | WBGene00006915 | ||
Gene | WBGene00000302 | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | To construct intestine specific cav-2 clones, we used Gateway multisite technology (Invitrogen, Paisley, UK). Individual entry clones containing the vha-6 promoter and cav-2 cDNA were produced and then combined in a Gateway reaction into the destination vector pHP2 (H. Peterkin and H. Baylis, unpublished data). The vha-6 promoter clone contained a fragment, similar to that previously used by Grant and colleagues (Chen et al., 2006), amplified using the oligonucleotides ggggacaagtttgtacaaaaaagcaggctcgcgttcaccactcgaccaccgaac and ggggacaacttttgtatacaaagttgttttttatgggttttggtaggttttag. The cav-2 cDNA was amplified using the oligonucleotides ggggacaacttttctatacaaagttgaaaaatgactcgtcagaatacttccgaaag and ggggacaactttattatacaaagttgttaaacatgatgaatgtgtttttc. | ||
Used_for | Transgene_construct | WBTransgene00020905 | |
Reference | WBPaper00046406 |