Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00020480

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00020480Summary[vha-6p::cav-2]
Driven_by_geneWBGene00006915
GeneWBGene00000302
Type_of_constructTranscriptional_fusion
Construction_summaryTo construct intestine specific cav-2 clones, we used Gateway multisite technology (Invitrogen, Paisley, UK). Individual entry clones containing the vha-6 promoter and cav-2 cDNA were produced and then combined in a Gateway reaction into the destination vector pHP2 (H. Peterkin and H. Baylis, unpublished data). The vha-6 promoter clone contained a fragment, similar to that previously used by Grant and colleagues (Chen et al., 2006), amplified using the oligonucleotides ggggacaagtttgtacaaaaaagcaggctcgcgttcaccactcgaccaccgaac and ggggacaacttttgtatacaaagttgttttttatgggttttggtaggttttag. The cav-2 cDNA was amplified using the oligonucleotides ggggacaacttttctatacaaagttgaaaaatgactcgtcagaatacttccgaaag and ggggacaactttattatacaaagttgttaaacatgatgaatgtgtttttc.
Used_forTransgene_constructWBTransgene00020905
ReferenceWBPaper00046406