WormBase Tree Display for Construct: WBCnstr00020296
expand all nodes | collapse all nodes | view schema
| WBCnstr00020296 | Summary | [CAV-2::GFP] | |
|---|---|---|---|
| Driven_by_gene | WBGene00000302 | ||
| Gene | WBGene00000302 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [CAV-2::GFP] translational fusion. Fusion proteins were generated with green fluorescent protein (GFP) inserted close to the 5' or 3' end of the gene to give N and C terminal fusions, respectively. Constructs included ca. 4 kb of DNA upstream of the ATG start (the forward primer was SP650: cgatctactatgcctccaatggg) and 2 kb of DNA downstream of the stop codon (the reverse primer was SP653: cgagtgaaagcacgtgacgac). | ||
| Used_for | Transgene_construct | WBTransgene00031751 | |
| Reference | WBPaper00046406 |
